Geneticist/Biologist only: Find out the disease causing mutation for 41 dog diseases plus frequencies ...

Completed Posted 7 years ago Paid on delivery
Completed Paid on delivery

I have a list of 41 genetic diseases in dogs. I need the following:

1) Find out which gene is responsible for the disease as well as which mutation causes the disease.

2) Get the genomic sequence of dogs flanking the mutation so a genetic test can be designed for it. (I need at least 100 bases upstream and downstream with the mutation shown in brackets. in this format:

ACTCGGAAATTCTCTTTATAGGATTCT(G/C)CGATCTCGAAAAGAGATCTTCTCG

3) Get me information if the disease is dominant, recessive or codominant

4) Get some information how common dis disease is in any dog breed

I will supply an excel sheet to fill in the details. the results must be entered into this excel sheet.

Biology Biotechnology Genetic Engineering Medical Scientific Research

Project ID: #10702909

About the project

8 proposals Remote project Active 7 years ago

Awarded to:

ayushi97

A Biotechnologist and genticist by education and intrest This is Ayushi an expert patent researcher, market researcher and academic writer with more than 3 years of working experience in patent support services, marke More

€55 EUR in 3 days
(5 Reviews)
3.5
animbcmh

I am a phd student, majored in animal genetics. One aim of my work is to find causal genes or mutations for disease and performance. So I am professional in your project. The one thing i am worried about is whether the More

€111 EUR in 5 days
(0 Reviews)
0.0

8 freelancers are bidding on average €136 for this job

shahzaib121

Hi Dear I have a lot of experience in BioInformatics. I have done many work in sequence alignment , Socring system,Pairwise Alignment ,Global & local pairwise alignment . I am expert in developing Algorithims I see y More

€200 EUR in 3 days
(0 Reviews)
0.0
punks013

Hello there! I am a bio technologist with research experience and also writing experience. I have written reports and projects before. And also have some projects in bioinformatics and miRna. I can surely do a good j More

€150 EUR in 3 days
(0 Reviews)
0.0
manwar4393

Dear sir I am web research, data entry and copy typing specialist. My typing speed is 100 word per minute. I am honest and hard worker. I will start now and deliver you before your deadline. I provide quality work an More

€44 EUR in 3 days
(0 Reviews)
1.4
CalebARoberts

This is something I do all the time for university assignments, and it's the easy part. I'll do it.

€166 EUR in 5 days
(0 Reviews)
0.0