Geneticist/Biologist only: Find out the disease causing mutation for 41 dog diseases plus frequencies ...
€30-250 EUR
Paid on delivery
I have a list of 41 genetic diseases in dogs. I need the following:
1) Find out which gene is responsible for the disease as well as which mutation causes the disease.
2) Get the genomic sequence of dogs flanking the mutation so a genetic test can be designed for it. (I need at least 100 bases upstream and downstream with the mutation shown in brackets. in this format:
ACTCGGAAATTCTCTTTATAGGATTCT(G/C)CGATCTCGAAAAGAGATCTTCTCG
3) Get me information if the disease is dominant, recessive or codominant
4) Get some information how common dis disease is in any dog breed
I will supply an excel sheet to fill in the details. the results must be entered into this excel sheet.
Project ID: #10702909
About the project
Awarded to:
8 freelancers are bidding on average €136 for this job
Hi Dear I have a lot of experience in BioInformatics. I have done many work in sequence alignment , Socring system,Pairwise Alignment ,Global & local pairwise alignment . I am expert in developing Algorithims I see y More
Dear sir I am web research, data entry and copy typing specialist. My typing speed is 100 word per minute. I am honest and hard worker. I will start now and deliver you before your deadline. I provide quality work an More
This is something I do all the time for university assignments, and it's the easy part. I'll do it.