Connectwise downstream it jobs

Filter

My recent searches
Filter by:
Budget
to
to
to
Type
Skills
Languages
    Job State
    457 connectwise downstream it jobs found, pricing in NZD

    ...We pay on an hourly basis. Our plan: Our aim is to deliver a quality file hosting service with genuine additional services to match it. This along with some useful extra features such as fast up/downstream, remote upload, report stats and more scheduled. Good support from us (to you) will be key to our growth. Our business model is all about working

    $6 / hr (Avg Bid)
    $6 / hr Avg Bid
    20 bids

    ...Management: Responsible for developing, coordinating and executing training for local sales force; Facilitate Physician to Physician training and selling; Development of downstream sales tools to support sales execution; Help the local franchises sales force with active field support; Actively participate in local sales meetings; Participate in main

    N/A
    N/A
    0 bids

    ...disease as well as which mutation causes the disease. 2) Get the genomic sequence of dogs flanking the mutation so a genetic test can be designed for it. (I need at least 100 bases upstream and downstream with the mutation shown in brackets. in this format: ACTCGGAAATTCTCTTTATAGGATTCT(G/C)CGATCTCGAAAAGAGATCTTCTCG 3) Get me information if the disease

    $280 (Avg Bid)
    $280 Avg Bid
    22 bids

    ...We pay on an hourly basis. Our plan: Our aim is to deliver a quality file hosting service with genuine additional services to match it. This along with some useful extra features such as fast up/downstream, remote upload, report stats and more scheduled. Good support from us (to you) will be key to our growth. Our business model is all about working

    $6 / hr (Avg Bid)
    $6 / hr Avg Bid
    14 bids

    Build a help desk/PSA system on the google cloud platform. The system would need to be simular to Autotask or ConnectWise.

    $3439 (Avg Bid)
    $3439 Avg Bid
    15 bids

    ...disease as well as which mutation causes the disease. 2) Get the genomic sequence of dogs flanking the mutation so a genetic test can be designed for it. (I need at least 100 bases upstream and downstream with the mutation shown in brackets. in this format: ACTCGGAAATTCTCTTTATAGGATTCT(G/C)CGATCTCGAAAAGAGATCTTCTCG 3) Get me information if the disease

    $354 (Avg Bid)
    $354 Avg Bid
    18 bids
    Trophy icon Grand Image Lean Logo Ended

    We would like a logo for our Lean Manufacturing material. The logo should use our current logo col...teamwork, and everyone working to improving quality together. Lean is about a system of departments working together, caring about other departments, especially those that are downstream in the manufacturing process. Attached is our high res logo.

    $38 (Avg Bid)
    Guaranteed
    $38
    9 entries

    We want to create 5 (five) "Project Scenarios" for Computer Science/IT engineering students. These Project Scenarios will be given to students for completing the design, development, testing and release of application projects. If you are awarded the project, we will send you a Template which you can use to define the Objective, Background, Functional

    $94 - $140
    $94 - $140
    0 bids

    We want to create 5 (five) 'Project Scenarios' for Computer Science/IT engineering students. These Project Scenarios will be given to students for completing the design, development, testing and release of application projects. If you are awarded the project, we will send you a Template which you can use to define the Objective, Background, Functional

    $198 (Avg Bid)
    $198 Avg Bid
    9 bids

    We want to create Project Scenarios for Computer Science/IT engineering students. These Project Scenarios will be given to students for completing the design, development, testing and release of application projects. If you are awarded the project, we will send you a Template which you can use to define the Objective, Background, Functional Requirement

    $116 (Avg Bid)
    Featured
    $116 Avg Bid
    2 bids

    We want to create Project Scenarios for Computer Science/IT engineering students. These Project Scenarios will be given to students for completing the design, development, testing and release of application projects. If you are awarded the project, we will send you a Template which you can use to define the Objective, Background, Functional Requirement

    $14 - $35
    $14 - $35
    0 bids

    ...premises, ...) if a user focuses one are another frame shows user ratings and comments. This content allows us to find the right freelancer with the skills we need. The downstream activities are the creation of an entire new website within a common CMS framework (joomla, wordpress, ...) that allows us to rate various areas that are selected in the

    $76 (Avg Bid)
    $76
    2 entries

    We need a logo designed for a new company. The company is called CH4 Software Ltd and we create software for the downstream gas industry. The CH4 in the company name is in reference to the chemical composition of Methane. I do not expect the logo to consist of molecular structures. We have a preference for thin stroke logo styles, although this is

    $100 (Avg Bid)
    Urgent
    $100 Avg Bid
    31 bids

    ...both upstream and downstream messaging. The basic functionality of the server will be to receive messages from android devices as well send messages from android devices. All messages received will be saved in a mysql database. There is lots of open source code available for this in github. Need an experienced developer to put it together. Detailed

    $359 (Avg Bid)
    $359 Avg Bid
    18 bids

    Need a mobile application Android + Windows as a user tool to book our products a+ as a administration tool f...mobile application Android + Windows as a user tool to book our products a+ as a administration tool for our logistics team to track the product / delivery. Feed data to our downstream apps for analytics purpose. Easy to handle and maintain.

    $94 (Avg Bid)
    $94 Avg Bid
    4 bids

    We use a product called "Connectwise" that uses an email templating system. The code is based on old fashioned HTML, you can see some sample html in the [login to view URL] file. I have also included the sample HTML file they provide for creating a template provided by the vendor. It's terrible. Basically, my website ([login to view URL] ) is currently

    $924 (Avg Bid)
    $924 Avg Bid
    12 bids
    Trophy icon Name GHSM Logistics Model Ended

    ...(software) that focuses on a global transportation and logistics modeling of the liquid fuels (crude oil and crude like) supply chain, immediately upstream and immediately downstream of the refineries. The scope of the model includes alternative modes of transport (tanker, pipeline, etc.) and storage for inventory along the path from crude production

    $76 (Avg Bid)
    Guaranteed Sealed
    $76
    38 entries

    1. Provide complete service for electronic on-boarding and certifying with all incoming FIX clients and ensure a successful hand-off to production 2. Cr...quickly test new releases and patches 4. Gather and analyze client requirements, and translate them into FIX specifications, or ROE rules specific to the client or their downstream target OMS(s)

    $62 / hr (Avg Bid)
    $62 / hr Avg Bid
    4 bids

    need some help to learn a little about antennas and frequencies etc. nice if I could have an excel document or just learn shapes how I can find out max downstream for LTE over 800 MHz I know it's 42 Mbit / s but I do not know how things I would arrive at the answer need to range widely too.

    $55 (Avg Bid)
    $55 Avg Bid
    11 bids

    We are looking for someone who can use the Connectwise API to build a website that will allow Connectwise users to create a ticket that will post the ticket as a "Job" in the users account on our website. The website will need to allow users to create an account and link their payment info to their account. Once the user moves their ticket to our

    $394 (Avg Bid)
    $394 Avg Bid
    8 bids

    ...(approx 7 to 10 columns). Detailed requirement is below: 1) Clear Reporting capabilities 2) Customer contact book 3) Entire Work order information (entire history). When was it received, approved, when billed on internal system, when on customer' vendor management system (does not involve integration to other systems) 4) Change requests information

    $1037 (Avg Bid)
    $1037 Avg Bid
    6 bids

    I have a wordpress based news application which has GCM implemented for push notifications. What I want to do now is implement Downstream messaging using GCM in such a manner that the app no longer continuously polls for update but is updated automatically as and when any data is uploaded on the server. Let me know if you have any query!

    $29 (Avg Bid)
    $29 Avg Bid
    4 bids

    We use both 3CX PBX and Connectwise. As a client calls I would like the contact card or Company card in Connectwise to be displayed so we can start entering information or creating Service tickets. If the contact card does not exist the opportunity should be there to create a new one [login to view URL] Knowledge

    $292 (Avg Bid)
    $292 Avg Bid
    1 bids

    ...activity for that lines up with the the time of the call would be created in ConnectWise. It would look at the extension that answered the call and have a lookup table where it would assign the user that answered the call to the activity in ConnectWise. In the notes section it would show the call duration and the location of the saved audio file that

    $402 (Avg Bid)
    $402 Avg Bid
    1 bids

    A website has already been developed with basic functionality for mobile browsers - $6k invested so far. It offers game play for a new game that I created for up to 5 people to play on a single device. First, I need this code translated into the Apple app store which will be the free version of the app - then into the Android store once complete.

    $79 / hr (Avg Bid)
    $79 / hr Avg Bid
    37 bids

    ...partner etc. Looking for a good seasoned wordpress experienced freelancer. If the project goes well, there are many more similar projects lined up and there is lot of downstream work too. The freelancer applying for the job must have good track record of quickly creating professional wordpress websites and at a decent rate. There will be a need to

    $184 (Avg Bid)
    $184 Avg Bid
    18 bids

    A} Implement GCM for push notification B)GCM Downstream messaging for app auto refresh C} Actionbar Height to 70 Dp

    $205 (Avg Bid)
    $205 Avg Bid
    2 bids

    I have an excel list that I'd like to use it as a template to create a project plan For example Line 1 - Identify all components upstream/downstream (main task) Line 2 - Applications CI (subtask) Line 3 - Servers CI The final user will be able to add mainly subtasks but also task in special case. Tasks and subtasks should be expandable

    $94 (Avg Bid)
    $94 Avg Bid
    7 bids

    Hi, My requirement is that I have a news application running on the App Store. I would like you to implement GCM in the said app for push notification as well as downstream messaging so the app receives a message from the server about new content being available on the server and only then fetches the posts. In the design aspect, I would like

    $294 (Avg Bid)
    $294 Avg Bid
    11 bids

    We currently have a small website that we need completely mapped out in ...reminder emails etc. Please refer to attachment for an example of how we would like it illustrated. However, unlike the attachment, we need it to be in a format that is clear and professionally presented. Please take into consideration that we will need to add txt downstream.

    $155 (Avg Bid)
    $155 Avg Bid
    8 bids

    ...integrate with the connectwise system allowing - Association of email to service ticket - Creation of Ticket if required - Retrieval and Update of service ticket details (Budget, Due Date, Status) - Creation of Time Entries (Using Default Entry Templates) - Retrieval and Update of Tasks - Creation of Tasks The connectwise API (https://developer

    $1871 (Avg Bid)
    $1871 Avg Bid
    10 bids

    ...integrate with the connectwise system allowing - Association of email to service ticket - Creation of Ticket if required - Retrieval and Update of service ticket details (Budget, Due Date, Status) - Creation of Time Entries (Using Default Entry Templates) - Retrieval and Update of Tasks - Creation of Tasks The connectwise API (https://developer

    $1588 (Avg Bid)
    $1588 Avg Bid
    21 bids

    I am looking for someone with ConnectWise CRM/PSA deployment expertise for integration help and ongoing support. The emphasis would be the implementation of best practice, automation and integration with our other software packages.

    CRM
    $43 / hr (Avg Bid)
    $43 / hr Avg Bid
    2 bids

    ...items in the database. (which is a composite key.) If item exists, it will need to be checked to see if it there are changes between the data in the database and the new data. If the item is new or there is a change, a flag needs to be set to allow for the data to be pushed into a downstream system easily. Each XML file will have the minimum of one child

    $827 (Avg Bid)
    $827 Avg Bid
    18 bids

    ...about to integrate the API's our website is [login to view URL] .we need to intigrate 2 API here. 1) connectwise : we need to intigrate the connectwise API into our site .so, we can get the contact into our site from connectwise. here is the place where we need to place that contacts [login to view URL]

    $811 (Avg Bid)
    $811 Avg Bid
    3 bids

    As with the previous report, this one intends to analyze the industrial differencies between Japan and the European Union in the sector of petroleum (upstream and downstream). The report is composed by three parts, each of which should have a length of 1-3 pages. Bibliographic referencies are extremely important. 1. Which EU firms, governments and/or

    $61 (Avg Bid)
    $61 Avg Bid
    1 bids

    We need someone who is pro efficient in integrating API. THe program is done in PHP MySQL and we need some one who can integrate the Connectwise and Hubspot using their PHP API Integration Kit.

    $282 (Avg Bid)
    $282 Avg Bid
    4 bids

    ...trying to develop a Mac OS application using xCode (Swift) to communicate with downstream devices connected via ethernet. We have developed power circuit breakers with digital control, all connected to a panel board then communicating to a user interface. The downstream devices have Atmel microprocessors communicating CAN bus to a CAN-Ethernet gateway

    $1957 (Avg Bid)
    $1957 Avg Bid
    14 bids

    ...will analyzes the intrastate water reallocation on agricultural and the effects on agricultural productivity. Particularly, we look at the 1976 Krishna Water Dispute Tribunal. It also reallocated the rights of three Indian states (Andhra Pradesh, Maharashtra and Karnataka) over the Krishna River. We will exploit district-time variation in access to river

    $43 (Avg Bid)
    $43 Avg Bid
    8 bids

    ...Capturing and storing all data for all business functions • Supporting advanced analytics capabilities • Sharing customer data quickly and generously with all those who need it • Continuously accommodating greater data volumes and new data sources Key Big Data Capabilities Software performance advantage and intelligent routing protocols enable

    $13747 (Avg Bid)
    $13747 Avg Bid
    10 bids

    Through Google Play Console (for App) Help with SERVICES & APIS GOOGLE CLOUD MESSAGING (GCM) in order to add to test App Facility to: SEND DOWNSTREAM MESSAGES and DEVICE GROUP MESSAGING Steps for Help will also include (I have all the Login Accounts and Ready made App in Store and a PHP page for sending and receiving linked to a sql

    $349 (Avg Bid)
    $349 Avg Bid
    6 bids

    ...with SERVICES & APIS GOOGLE CLOUD MESSAGING (GCM) and LINKING SENDER ID (GCM API Key or C2DM Client Login Token)~ in order to add to the App Facility to: SEND DOWNSTREAM MESSAGES and DEVICE GROUP MESSAGING Steps for Help will also include 1. Get a configuration file 2. Add the configuration file to your project 3. Editing the App

    $233 (Avg Bid)
    $233 Avg Bid
    2 bids

    ...with SERVICES & APIS GOOGLE CLOUD MESSAGING (GCM) and LINKING SENDER ID (GCM API Key or C2DM Client Login Token)~ in order to add to the App Facility to: SEND DOWNSTREAM MESSAGES and DEVICE GROUP MESSAGING Steps for Help will also include 1. Get a configuration file 2. Add the configuration file to your project 3. Editting the App

    $244 (Avg Bid)
    $244 Avg Bid
    3 bids

    Overview are stated in [login to view URL] 1. Research Topic of literature review is"the effect of integration and data standards on supply chain management, both upstream and downstream". 2. Personal reflection : [Lecture8] will be attach or send to you for review. minumum 500 words for this section. 3. Referencing : Harvard style. 4. Required length 3000

    $187 (Avg Bid)
    $187 Avg Bid
    1 bids

    ...integrate with the connectwise system allowing - Association of email to service ticket - Creation of Ticket if required - Retrieval and Update of service ticket details (Budget, Due Date, Status) - Creation of Time Entries (Using Default Entry Templates) - Retrieval and Update of Tasks - Creation of Tasks The connectwise API (https://developer

    $863 (Avg Bid)
    $863 Avg Bid
    6 bids

    We need to create SQL queries to retrieve data from a database and then create reports using SQL Reporting services. The underlying application that is the source of ...to create SQL queries to retrieve data from a database and then create reports using SQL Reporting services. The underlying application that is the source of the data is ConnectWise.

    $918 (Avg Bid)
    $918 Avg Bid
    13 bids

    ...state 2. Throughput 3. Packet delay 4. Duplicate byte percentage It is basically a multi-hop network protocol that exploits packet overhearing and incremental redundancy. It first finds a path from the source and destination. The downstream nodes will inform the upstream nodes if it receives a packet, either complete or with some errors. The upstream

    $329 (Avg Bid)
    $329 Avg Bid
    1 bids

    I need someone to write a report on the oil and gas sector in Singapore (mostly downstream refineries). Topics to include: 1) Introduction to the oil and gas sector in Singapore 2) The oil companies and nature of their operation 3) history of the industry 4) current developments 5) future developments and growth 6) type of jobs available

    $88 (Avg Bid)
    $88 Avg Bid
    15 bids

    I will be needing an in depth analysis and explanation of how to set up both downstream and upstream BGP session on a single machine. Also the use of linux networking namespaces to enable properly routed traceroutes

    $236 (Avg Bid)
    $236 Avg Bid
    1 bids

    I have two projects that are currently pending. I need top project managmer to handle this project and bring it to completion by the end of the April. I need a really project management skill to handle this project for me. I have the designs for both websites already. All i need is committed, honesty, hard working and skilled person to handle the project

    $417 (Avg Bid)
    $417 Avg Bid
    5 bids